Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › MC11216
          Assay Name: hsa-miR-660-5p
          miRBase Accession Number: MI0003684
          miRBase Version: v22.1
          Chromosome Location: Chr.X: 50013241 - 50013337 [+] on Build GRCh38
          Mature miRNA Sequence: UACCCAUUGCAUAUCGGAGUUG
          Species: Human, Callithrix jacchus, Daubentonia madagascariensis, Dog, Gorilla gorilla, Horse, Pan paniscus, Pan troglodytes, Papio hamadryas, Pig, Pongo pygmaeus, Pteropus alecto, Rhesus monkey
          Product Type: mirVana® miRNA mimic
          Assay ID MC11216

          Purification
          Size
          Availability Made To Order
          Catalog # 4464066
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000113, mir-188

          Mature miRNA Sequence:

          UACCCAUUGCAUAUCGGAGUUG

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Human hsa-miR-660-5p MIMAT0003338
          Callithrix jacchus cja-miR-660 MIMAT0039432
          Daubentonia madagascariensis dma-miR-660 MIMAT0049268
          Dog cfa-miR-660 MIMAT0006760
          Gorilla gorilla ggo-miR-660 MIMAT0024164
          Horse eca-miR-660 MIMAT0013241
          View More Rows
          Pan paniscus ppa-miR-660 MIMAT0049103
          Pan troglodytes ptr-miR-660 MIMAT0008308
          Papio hamadryas pha-miR-660 MIMAT0049544
          Pig ssc-miR-660 MIMAT0041612
          Pongo pygmaeus ppy-miR-660 MIMAT0016092
          Pteropus alecto pal-miR-660-5p MIMAT0039997
          Rhesus monkey mml-miR-660-5p MIMAT0006499

          Stem-loop Details



          Human

          Stem-loop ID hsa-mir-660
          Stem-loop Accession # MI0003684
          Stem-loop Sequence
          CUGCUCCUUCUCCCAUACCCAUUGCAUAUCGGAGUUGUGAAUUCUCAAAACACCUCCUGUGUGCAUGGAUUACAGGAGGGUGAGCCUUGUCAUCGUG
          Chromosome Location Chr. X - 50013241 - 50013337 [+] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0003338
          miRBase ID: hsa-miR-660-5p
          Mature miRNA Sequence: UACCCAUUGCAUAUCGGAGUUG
          Chromosome Location: Chr. X - 50013241 - 50013337 [+] on Build GRCh38

          Callithrix jacchus

          Stem-loop ID cja-mir-660
          Stem-loop Accession # MI0031953
          Stem-loop Sequence
          GCUCCUUCUCCCAUACCCAUUGCAUAUCGGAGUUGUGAAUUCUCAAAACACCUCCUGUGUGCAUGGAUUACAGGAGGGUGAGC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0039432
          miRBase ID: cja-miR-660
          Mature miRNA Sequence: UACCCAUUGCAUAUCGGAGUUG
          Chromosome Location: NA

          Daubentonia madagascariensis

          Stem-loop ID dma-mir-660
          Stem-loop Accession # MI0039996
          Stem-loop Sequence
          UACCCAUUGCAUAUCGGAGUUGUGAAUUCUCAAAACACCUCCUGUGUGCAUGGAUUAC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0049268
          miRBase ID: dma-miR-660
          Mature miRNA Sequence: UACCCAUUGCAUAUCGGAGUUG
          Chromosome Location: NA

          Dog

          Stem-loop ID cfa-mir-660
          Stem-loop Accession # MI0008186
          Stem-loop Sequence
          UACCCAUUGCAUAUCGGAGUUGUGAAUUCUCAAAGCACCUCCUGUGUGCAUGGAUUACA
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0006760
          miRBase ID: cfa-miR-660
          Mature miRNA Sequence: UACCCAUUGCAUAUCGGAGUUG
          Chromosome Location: NA

          Gorilla gorilla

          Stem-loop ID ggo-mir-660
          Stem-loop Accession # MI0020711
          Stem-loop Sequence
          AUGAACUGCUCCUUCUCCCAUACCCAUUGCAUAUCGGAGUUGUGAAUUCUCAAAACACCUCCUGUGUGCAUGGAUUACAGGAGGGUGAGCCUUGUCAUCGUGAAUCUUCU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0024164
          miRBase ID: ggo-miR-660
          Mature miRNA Sequence: UACCCAUUGCAUAUCGGAGUUG
          Chromosome Location: NA

          Horse

          Stem-loop ID eca-mir-660
          Stem-loop Accession # MI0012983
          Stem-loop Sequence
          CUGCUCCUUCUCCUGUACCCAUUGCAUAUCGGAGUUGUGAAUUCUGAAAGCACCUCCUGUGUGCAUGGAUUACAGGAGGGCGAGCCUUGUCAUCAUG
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0013241
          miRBase ID: eca-miR-660
          Mature miRNA Sequence: UACCCAUUGCAUAUCGGAGUUG
          Chromosome Location: NA

          Pan paniscus

          Stem-loop ID ppa-mir-660
          Stem-loop Accession # MI0039815
          Stem-loop Sequence
          UACCCAUUGCAUAUCGGAGUUGUGAAUUCUCAAAACACCUCCUGUGUGCAUGGAUUAC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0049103
          miRBase ID: ppa-miR-660
          Mature miRNA Sequence: UACCCAUUGCAUAUCGGAGUUG
          Chromosome Location: NA

          Pan troglodytes

          Stem-loop ID ptr-mir-660
          Stem-loop Accession # MI0008845
          Stem-loop Sequence
          UGCUCCUUCUCCCAUACCCAUUGCAUAUCGGAGUUGUGAAUUCUCAAAACACCUCCUGUGUGCAUGGAUUACAGGAGGGUGAGCCUUGUCAUCGUG
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0008308
          miRBase ID: ptr-miR-660
          Mature miRNA Sequence: UACCCAUUGCAUAUCGGAGUUG
          Chromosome Location: NA

          Papio hamadryas

          Stem-loop ID pha-mir-660
          Stem-loop Accession # MI0040311
          Stem-loop Sequence
          UACCCAUUGCAUAUCGGAGUUGUAAAUUCUCAAAACACCUCCUGUGUGCAUGGAUUAC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0049544
          miRBase ID: pha-miR-660
          Mature miRNA Sequence: UACCCAUUGCAUAUCGGAGUUG
          Chromosome Location: NA

          Pig

          Stem-loop ID ssc-mir-660
          Stem-loop Accession # MI0033413
          Stem-loop Sequence
          CUCCCAUACCCAUUGCAUAUCGGAGUUGUGAAUUCUCAAAGCACCUCCUAUGUGCAUGGUUUACAGGAG
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0041612
          miRBase ID: ssc-miR-660
          Mature miRNA Sequence: UACCCAUUGCAUAUCGGAGUUG
          Chromosome Location: NA

          Pongo pygmaeus

          Stem-loop ID ppy-mir-660
          Stem-loop Accession # MI0015133
          Stem-loop Sequence
          CUGCUCCUUCUCCCAUACCCAUUGCAUAUCGGAGUUGUGAAUUCUCAAAACACCUCCUGUGUGCAUGGAUUACAGGAGGGUGAGCCUUGUCAUCGUG
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0016092
          miRBase ID: ppy-miR-660
          Mature miRNA Sequence: UACCCAUUGCAUAUCGGAGUUG
          Chromosome Location: NA

          Pteropus alecto

          Stem-loop ID pal-mir-660
          Stem-loop Accession # MI0032440
          Stem-loop Sequence
          UACCCAUUGCAUAUCGGAGUUGUGAAUUCUCAAAGCACCUCCUGUGUGCAUGGAUU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0039997
          miRBase ID: pal-miR-660-5p
          Mature miRNA Sequence: UACCCAUUGCAUAUCGGAGUUG
          Chromosome Location: NA

          Rhesus monkey

          Stem-loop ID mml-mir-660
          Stem-loop Accession # MI0007901
          Stem-loop Sequence
          CUGCUCCUUCUCCCAUACCCAUUGCAUAUCGGAGUUGUAAAUUCUCAAAACACCUCCUGUGUGCAUGGAUUACAGGAGGGUGAGCCUUGUCAUCGUG
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0006499
          miRBase ID: mml-miR-660-5p
          Mature miRNA Sequence: UACCCAUUGCAUAUCGGAGUUG
          Chromosome Location: NA


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Hs03304909_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM11216
          Ambion® Pre-miR™ miRNA Precursor : PM11216
          TaqMan™ MicroRNA Assay : 001515
          mirVana® miRNA inhibitor : MH11216
          TaqMan™ Advanced miRNA Assay : 478192_mir


          miRBase Alias:

          Human: hsa-miR-660 (v17)
          Macaca mulatta: mml-miR-660 (v19)

          Back To Top

          Related Products

          • Anti-GAPDH, Mouse Monoclonal 6C5
          • Anti-β-Actin, Mouse Monoclonal AC-15
          • TaqMan® Gene Expression Cells-to-CT™
          • Neon™ Transfection System 100 µL Kit
          • Lipofectamine™ RNAiMAX Transfection Reagent
          • Invivofectamine 2.0
          • Neon™ Transfection System
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Spain flag icon
          Spain

          TEST

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline