Hamburger Menu Button
Thermo Fisher Scientific Logo
登入
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Tubes
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Clinical Genomics
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO 和 CRO 服務
    • CDMO 服務
    • 臨床試驗 CRO 服務
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • Register for an Account
    • How to Order
    • Instrument Support
    • Technical Support Centers
    • Learning Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • 快速訂購
          • 登入
            登入
            Don't have an account ? Create Account
            • 帳戶
            • 訂單
            • 訂製產品與專案
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › MC11545
          Assay Name: hsa-miR-637
          miRBase Accession Number: MI0003652
          miRBase Version: v22.1
          Chromosome Location: Chr.19: 3961414 - 3961512 [-] on Build GRCh38
          Mature miRNA Sequence: ACUGGGGGCUUUCGGGCUCUGCGU
          Species: Human, Pan troglodytes
          Product Type: mirVana® miRNA mimic
          Assay ID MC11545

          Purification
          Size
          Availability Made To Order
          Catalog # 4464066
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000597, mir-637

          Mature miRNA Sequence:

          ACUGGGGGCUUUCGGGCUCUGCGU

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Human hsa-miR-637 MIMAT0003307
          Pan troglodytes ptr-miR-637 MIMAT0008293

          Stem-loop Details



          Human

          Stem-loop ID hsa-mir-637
          Stem-loop Accession # MI0003652
          Stem-loop Sequence
          UGGCUAAGGUGUUGGCUCGGGCUCCCCACUGCAGUUACCCUCCCCUCGGCGUUACUGAGCACUGGGGGCUUUCGGGCUCUGCGUCUGCACAGAUACUUC
          Chromosome Location Chr. 19 - 3961414 - 3961512 [-] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0003307
          miRBase ID: hsa-miR-637
          Mature miRNA Sequence: ACUGGGGGCUUUCGGGCUCUGCGU
          Chromosome Location: Chr. 19 - 3961414 - 3961512 [-] on Build GRCh38

          Pan troglodytes

          Stem-loop ID ptr-mir-637
          Stem-loop Accession # MI0008830
          Stem-loop Sequence
          UGGCUAAGGUGUUGGCUCCGGCUCCCCACUGCAGUUACCCUCCCCUCGGCGUUACUGAGCACUGGGGGCUUUCGGGCUCUGCGUCUGCACAGAUACUU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0008293
          miRBase ID: ptr-miR-637
          Mature miRNA Sequence: ACUGGGGGCUUUCGGGCUCUGCGU
          Chromosome Location: NA


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Hs03295635_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM11545
          Ambion® Pre-miR™ miRNA Precursor : PM11545
          TaqMan™ MicroRNA Assay : 001581
          mirVana® miRNA inhibitor : MH11545
          TaqMan™ Advanced miRNA Assay : 478186_mir

          Back To Top

          Related Products

          • Anti-GAPDH, Mouse Monoclonal 6C5
          • Anti-β-Actin, Mouse Monoclonal AC-15
          • TaqMan® Gene Expression Cells-to-CT™
          • Neon™ Transfection System 100 µL Kit
          • Lipofectamine™ RNAiMAX Transfection Reagent
          • Invivofectamine 2.0
          • Neon™ Transfection System
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Hong Kong flag icon
          Hong Kong

          Your items have has been added!


          Host server : magellan-search-blue-74d7b4b4d9-zrl6d:80/100.66.77.38:80.
          git-commit: 7aafa54bd143a040505a257d2a3ebda4095a617f
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.56.0-Offline