Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign In
Don't have an account ? Create Account
  • Applications
    • Real-Time PCR
    • Oligos, Primers, Probes and Genes
    • Cloning
    • Protein Biology
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Cell Analysis
    • Mass Spectrometry
    • Chromatography
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Online Order
    • Custom Primers & TaqMan Probes
    • miRNA Mimics & Inhibitors
    • Stealth RNAi / siRNA
    • Silencer Select siRNAs
    • Custom DNA Oligos
    • GeneArt Services
    • GeneArt Strings DNA Fragments
    • TrueGuide CRISPR gRNA
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • See all online orderable products
  • Services
    • Custom Services
    • Instrument Qualification Services
    • Technical Services
    • Pipette Services
    • Sample Request
    • Instrument Maintenance Services
    • Repairs and Relocation Services
    • OEM and Licensing Services
    • Events, Seminars, Training
    • Unity Lab Services
    • See all services
  • Support
    • Catalogs
    • Application Notes
    • Safety Data Sheets
    • Legal and Regulatory
    • Certificates of Analysis Search
    • Nunc/Nalgene Product Certificates
    • e-learning
    • FAQs
    • Learning Centers
    • Technical Support Centers
    • See all help and support topics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign In
            Sign In
            Don't have an account ? Create Account
            • Connect Your Lab
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › MH25989
          Assay Name: cgr-miR-1903
          miRBase Accession Number: MI0020435
          miRBase Version: v22.1
          Chromosome Location: -
          Mature miRNA Sequence: CUGGAAGAGGAACAAGUG
          Species: Cricetulus griseus
          Product Type: mirVana® miRNA inhibitor
          Assay ID MH25989

          Purification
          Size
          Availability Made To Order
          Catalog # 4464084
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Mature miRNA Sequence:

          CUGGAAGAGGAACAAGUG

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Cricetulus griseus cgr-miR-1903 MIMAT0023820

          Stem-loop Details



          Cricetulus griseus

          Stem-loop ID cgr-mir-1903
          Stem-loop Accession # MI0020435
          Stem-loop Sequence
          UGUGAGCCACUAUGUUGGUGCUAGGAAUUGAACUCAGGUCCUCUGGAAGAGGAACAAGUGCUCUCACCUG
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0023820
          miRBase ID: cgr-miR-1903
          Mature miRNA Sequence: CUGGAAGAGGAACAAGUG
          Chromosome Location: NA


          Back To Top

          More Information




          Related Products

          TaqMan™ MicroRNA Assay : 477172_mat
          mirVana® miRNA mimic : MC25989

          Back To Top

          Related Products

          • Anti-GAPDH, Mouse Monoclonal 6C5
          • Anti-β-Actin, Mouse Monoclonal AC-15
          • TaqMan® Gene Expression Cells-to-CT™
          • Neon™ Transfection System 100 µL Kit
          • Lipofectamine™ RNAiMAX Transfection Reagent
          • Invivofectamine 2.0
          • Neon™ Transfection System
          Ordering Plus Icon Minus Icon
          • Online Orderable Products
          • Privacy Policy for Online Ordering
          • Act on Specified Commercial Transactions
          • About Returns
          • About Displayed Prices
          • About Shipping Fees
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Study information disclosure
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Seminars
          • Blog
          About Thermo Fisher Plus Icon Minus Icon
          • Corporate Information
          • Social Responsibility (CSR)
          • Enhancing Customer Experience
          • Careers Careers
          • News
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Japan flag icon
          Japan

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-pgj68:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline