Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign In
Don't have an account ? Create Account
  • Applications
    • Real-Time PCR
    • Oligos, Primers, Probes and Genes
    • Cloning
    • Protein Biology
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Cell Analysis
    • Mass Spectrometry
    • Chromatography
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Online Order
    • Custom Primers & TaqMan Probes
    • miRNA Mimics & Inhibitors
    • Stealth RNAi / siRNA
    • Silencer Select siRNAs
    • Custom DNA Oligos
    • GeneArt Services
    • GeneArt Strings DNA Fragments
    • TrueGuide CRISPR gRNA
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • See all online orderable products
  • Services
    • Custom Services
    • Instrument Qualification Services
    • Technical Services
    • Pipette Services
    • Sample Request
    • Instrument Maintenance Services
    • Repairs and Relocation Services
    • OEM and Licensing Services
    • Events, Seminars, Training
    • Unity Lab Services
    • See all services
  • Support
    • Catalogs
    • Application Notes
    • Safety Data Sheets
    • Legal and Regulatory
    • Certificates of Analysis Search
    • On-demand videos
    • FAQs
    • Learning Centers
    • Technical Support Centers
    • See all help and support topics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign In
            Sign In
            Don't have an account ? Create Account
            • Connect Your Lab
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › Mm03306922_pri
          Assay Name:
          mmu-mir-322
          Stem-loop ID:
          mmu-mir-322
          Mapped to miRBase Version:
          v22.1
          Chromosome Location:
          Chr.X: 53054255 - 53054349 [-] on Build GRCm38
          Stem-loop Location:
          Chr.X: 53054255 - 53054349 [-] on Build GRCm38
          Mature miRNA ID:
          mmu-miR-322-3p mmu-miR-322-5p
          Species:
          Mouse
          Product Type:
          TaqMan™ Pri-miRNA Assay
          Assay ID Mm03306922_pri
          Size
          Availability Made To Order
          Catalog # 4427012
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Amplicon Length:

          75

          Chromosome Location:

          Chr. X - 53054552 - 53054552 [+] on 53054552 Build GRCm38

          Species:

          Mouse

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Mouse mmu-miR-322-3p MIMAT0000549
          Mouse mmu-miR-322-5p MIMAT0000548

          Stem-loop Details



          Mouse

          Stem-loop ID mmu-mir-322
          Stem-loop Accession # MI0000590
          Stem-loop Sequence
          CCUCGUUGACUCCGAAGGGCUGCAGCAGCAAUUCAUGUUUUGGAGUAUUGCCAAGGUUCAAAACAUGAAGCGCUGCAACACCCCUUCGUGGGGAA
          Chromosome Location Chr. X - 53054255 - 53054349 [-] on Build GRCm38
          Mature MicroRNA miRBase Accession #: MIMAT0000549
          miRBase ID: mmu-miR-322-3p
          Mature miRNA Sequence: AAACAUGAAGCGCUGCAACAC
          Chromosome Location: Chr. X - 53054255 - 53054349 [-] on Build GRCm38

          miRBase Accession #: MIMAT0000548
          miRBase ID: mmu-miR-322-5p
          Mature miRNA Sequence: CAGCAGCAAUUCAUGUUUUGGA
          Chromosome Location: Chr. X - 53054255 - 53054349 [-] on Build GRCm38

          Gene Family ID MIPF0000164, mir-322
          Distance to Amplicon 170 bases

          Back To Top

          More Information




          Related Products

          Ambion® Anti-miR™ miRNA Inhibitor : AM12958
          Ambion® Pre-miR™ miRNA Precursor : PM12958
          TaqMan™ MicroRNA Assay : 002506
          mirVana® miRNA inhibitor : MH12958
          mirVana® miRNA mimic : MC12958
          TaqMan™ Advanced miRNA Assay : mmu481776_mir
          Ambion® Anti-miR™ miRNA Inhibitor : AM11080
          Ambion® Pre-miR™ miRNA Precursor : PM11080
          TaqMan™ MicroRNA Assay : 001076
          mirVana® miRNA inhibitor : MH11080
          mirVana® miRNA mimic : MC11080
          TaqMan™ Advanced miRNA Assay : rno481051_mir
          TaqMan™ Advanced miRNA Assay : mmu481051_mir

          Back To Top

          Related Products

          • High Capacity RNA-to-cDNA Kit
          • SuperScript® IV VILO™ Master Mix
          • TaqMan® Universal PCR Master Mix
          • TaqMan® Fast Advanced Master Mix
          Ordering Plus Icon Minus Icon
          • Online Orderable Products
          • Privacy Policy for Online Ordering
          • Act on Specified Commercial Transactions
          • About Returns
          • About Displayed Prices
          • About Shipping Fees
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Study information disclosure
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Seminars
          • Blog
          About Thermo Fisher Plus Icon Minus Icon
          • Corporate Information
          • Social Responsibility (CSR)
          • Enhancing Customer Experience
          • Careers Careers
          • News
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Japan flag icon
          Japan

          Your items have has been added!


          Host server : magellan-search-blue-74d7b4b4d9-6qggw:80/100.66.76.149:80.
          git-commit: 7aafa54bd143a040505a257d2a3ebda4095a617f
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.56.0-Offline