Hamburger Menu Button
Thermo Fisher Scientific Logo
로그인
회원이 아니신가요? 계정 생성하기
  • 모든 제품 주문
    • 항체
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR 분석
    • 피펫 및 피펫 팁
    • 실험실용 원심분리기
    • 초저온 냉동고
    • 분광학
    • 비이커
    • PCR 장비 및 용품
    • 제품 카테고리 전체보기
  • 응용 분야 및 기법
    • 세포 분석
    • 실험실 장비
    • Real-Time PCR
    • PCR
    • 크로마토그래피
    • 세포 배양 및 트랜스펙션
    • DNA/RNA 추출과 분석
    • 단백질 생물학
    • 유세포분석
    • 화학 제품
    • 응용 분야 및 기법 전체보기
  • 서비스
    • 맞춤형 서비스
    • 엔터프라이즈급 실험실 정보 처리
    • 360° CDMO 및 CRO 서비스
    • CDMO 서비스
    • 임상시험 CRO 서비스
    • 장비 서비스
    • 교육 서비스
    • Unity Lab Services
    • 서비스 전체 보기
  • 지원
    • 고객센터
    • 문의하기
    • 시험성적서(COA) 및 적합성 인증서(COC)
    • Safety Data Sheets (SDS)
    • 매뉴얼
    • 인용 및 참고 문헌
    • 기기 지원
    • 기술 자료/제품 FAQ
    • 학습 센터
    • 지원 메뉴 전체보기
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • 문의하기
  • 빠른 주문
  • 주문 현황
  • 제품 문서 검색
Thermo Fisher Scientific Logo

Search

전체검색
Search button
          • 주문 현황
          • 빠른주문
          • 로그인
            로그인
            회원이 아니신가요? 계정 생성하기
            • 계정정보
            • 주문내역조회
            • 커스텀제품 및 프로젝트
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_154823200_10
          See other NUDT15 GT Assays ›
          SNP ID:
          rs116855232
          Gene
          NUDT15 SUCLA2
          Gene Name
          nudix hydrolase 15
          succinate-CoA ligase ADP-forming beta subunit
          Set Membership:
          -
          Chromosome Location:
          Chr.13: 48045719 - 48045719 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          CCTGGACCAGCTTTTCTGGGGACTG[C/T]GTTGTTTAAAAGAACAAGGCTATGA

          Assay ID C_154823200_10
          Size
          재고 정보 주문접수 후 제작
          Catalog # 4351379
          제품 정가
          Your Price
          온라인 행사가:
          공급가 확인 ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay 상세 정보



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 615792 MIM: 603921

          Literature Links:

          NUDT15 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.04)
          (0.96)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.10)
          (0.90)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.07)
          (0.93)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.00)
          (1.00)
          AMR
          T (0.05)
          (0.95)
          NUDT15 - nudix hydrolase 15
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001304745.1 595 Intron NP_001291674.1
          NM_018283.3 595 Missense Mutation CGT,TGT R,C 139 NP_060753.1
          SUCLA2 - succinate-CoA ligase ADP-forming beta subunit
          There are no transcripts associated with this gene.

          Back To Top

          추가 정보


          Important Information

          Assay C_154823200_10 detects the common NUDT15*2,*3 415C>T SNP, which is adjacent to the rare NUDT15*4 416G>A SNP that is detected by assay C_162697298_10. These two SNP assays can be used to detect the 3 possible haplotypes described for this locus (www.pharmvar.org/gene/NUDT15; minor alleles 415T and 416A do not occur together in a haplotype). Run both assays separately on the same samples and analyze data as described in the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 5 section 'TaqMan DME genotyping assays to triallelic SNPs and adjacent SNP targets'.
          Assay C_162697298_10 interrogates NUDT15*4 416G>A SNP (rs147390019).

          Gene Ontology Categories:

          Function(s) Process(es)

          dGTP catabolic process
          nucleobase-containing small molecule catabolic process
          8-oxo-7,8-dihydroguanosine triphosphate pyrophosphatase activity
          nucleoside-diphosphatase activity
          8-oxo-7,8-dihydrodeoxyguanosine triphosphate pyrophosphatase activity
          metal ion binding

          Back To Top

          관련 제품

          • TaqMan® Genotyping Master Mix
          온라인 주문 Plus Icon Minus Icon
          • 주문 현황
          • 주문 지원
          • 빠른 주문
          • Supply Center
          • eProcurement
          지원 Plus Icon Minus Icon
          • Help and Support
          • 고객 센터
          • 기술 지원 센터
          • 제품 문서 검색
          • 사이트 문제 보고
          교육 및 이벤트 Plus Icon Minus Icon
          • 교육 센터
          • 프로모션
          • 이벤트 및 웨비나
          • 소셜 미디어
          About Thermo Fisher Plus Icon Minus Icon
          • 소개 소개
          • 채용 채용
          • 투자자 투자자
          • 뉴스 뉴스
          • 사회적 책임 사회적 책임
          • Trademarks
          • 공정거래 공정거래
          • 정책 및 고지
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • 이용 약관
          • 개인정보 처리방침
          • 가격 및 운임 정책
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Korea flag icon
          Korea

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          써모 피셔 사이언티픽 코리아 주식회사
          대표자 : 석수진
          사업자 등록번호 : 117-81-46910
          입금계좌 : 하나은행 336-890014-06204
          (예금주 : 써모피셔사이언티픽코리아 주식회사)

           

          써모 피셔 사이언티픽 솔루션스 유한회사
          대표자 : 석수진
          사업자 등록번호 : 114-86-04783
          입금계좌 : 신한은행 140-004-396660
          (예금주 : 써모피셔사이언티픽솔루션스 유한회사)

           

          주소 : 서울시 강남구 광평로 281 수서오피스빌딩 12층 06349 | 통신판매업신고번호 : 2015-서울강남-00898

          ISMS Logo

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-5xfkf:80/100.66.78.86:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline