Search
LOADING 
- SNP ID:
- rs201450524
- Gene
-
THEG - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.19: 362277 - 362277 on Build GRCh38
- Polymorphism:
- A/G, Transition Substitution
- Context Sequence [VIC/FAM]:
GGCAAGCTCATAGAGGCGAGGGGAC[A/G]CCTGTCGTATCCCTCGTTGAGGCCC
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609503
|
||||||||||||||||||||
Literature Links: |
THEG PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| THEG - theg spermatid protein | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_016585.4 | 1808 | Missense Mutation | NP_057669.1 | |||
| NM_199202.2 | 1808 | Missense Mutation | NP_954672.1 | |||
| XM_011528049.2 | 1808 | Missense Mutation | XP_011526351.1 | |||
| XM_011528050.2 | 1808 | Missense Mutation | XP_011526352.1 | |||
| XM_011528051.2 | 1808 | Missense Mutation | XP_011526353.1 | |||
| XM_011528052.2 | 1808 | Intron | XP_011526354.1 | |||
Back To TopMore Information
Additional Information:
For this assay, SNP(s) [rs3764656] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Ontology Categories:
Back To Top