Search
LOADING 
- SNP ID:
- rs779733612
- Gene
-
IL6RLOC101928101 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.1: 154410086 - 154410086 on Build GRCh38
- Polymorphism:
- T/A, Transversion substitution
- Context Sequence [VIC/FAM]:
GAGCAGAGGGCTCTGTGGGGACACA[T/A]GGATGCTCCCTGCCCTGGAGAAGTA
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
4 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 147880
|
||||||||||||||||||||
Literature Links: |
IL6R PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| IL6R - interleukin 6 receptor | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_000565.3 | Intron | NP_000556.1 | ||||
| NM_001206866.1 | Intron | NP_001193795.1 | ||||
| NM_181359.2 | Intron | NP_852004.1 | ||||
| XM_005245139.1 | Intron | XP_005245196.1 | ||||
| XM_005245140.2 | Intron | XP_005245197.1 | ||||
| XM_006711298.1 | Intron | XP_006711361.1 | ||||
| XM_006711299.3 | Intron | XP_006711362.1 | ||||
| XM_017001199.1 | Intron | XP_016856688.1 | ||||
| XM_017001200.1 | Intron | XP_016856689.1 | ||||
| XM_017001201.1 | Intron | XP_016856690.1 | ||||
| LOC101928101 - uncharacterized LOC101928101 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
Back To Top