Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_990000001_10
          See other AMELX GT Assays ›
          SNP ID:
          hCV990000001
          Gene
          AMELX ARHGAP6
          Gene Name
          amelogenin, X-linked
          Rho GTPase activating protein 6
          Set Membership:
          -
          Chromosome Location:
          Chr.X: 11296922 - 11296922 on Build GRCh38
          Polymorphism:
          -/AAGTGG, Insertion/deletion
          Context Sequence [VIC/FAM]:

          GTGTTGATTCTTTATCCCAGATG[-/AAGTGG]TTTCTCAAGTGGTCCTGATTTT

          Assay ID C_990000001_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 300391 MIM: 300118

          Literature Links:

          AMELX PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          AMELX - amelogenin, X-linked
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001142.2 Intron NP_001133.1
          NM_182680.1 Intron NP_872621.1
          NM_182681.1 Intron NP_872622.1
          ARHGAP6 - Rho GTPase activating protein 6
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001287242.1 Intron NP_001274171.1
          NM_006125.2 Intron NP_006116.2
          NM_013423.2 Intron NP_038267.1
          NM_013427.2 Intron NP_038286.2

          Back To Top

          More Information


          Important Information

          C_990000001_10 targets a gender-specific polymorphic region in the amelogenin gene that is commonly used in forensic sex determination tests. A 6 nt deletion occurs in the X-specific amelogenin gene (B37/hg19 genome locations: chrX:11315039 and chrY:6737949-6737954). The VIC dye probe detects X-chromosome sequences and the FAM dye probe detects Y-chromosome sequences; male samples will run in the heterozygous cluster position. Some males lack the Y-specific amelogenin gene and will type as female, thus C_990000001_10 should be run in combination with a Y-chromosome assay to identify any mistyped individuals. For more information, go to:http://www.cstl.nist.gov/strbase/Amelogenin.htm

          Panther Classification:

          Molecular Function -

          GTPase-activating protein

          Gene Ontology Categories:

          Function(s) Process(es)

          osteoblast differentiation
          epithelial to mesenchymal transition
          chondrocyte differentiation
          cell adhesion
          signal transduction
          cell proliferation
          biomineral tissue development
          positive regulation of collagen biosynthetic process
          tooth mineralization
          odontogenesis of dentin-containing tooth
          ion homeostasis
          enamel mineralization
          positive regulation of tooth mineralization
          Rho protein signal transduction
          positive regulation of signal transduction
          actin filament polymerization
          positive regulation of GTPase activity
          focal adhesion assembly
          regulation of small GTPase mediated signal transduction
          negative regulation of stress fiber assembly
          negative regulation of focal adhesion assembly
          protein binding
          growth factor activity
          structural constituent of tooth enamel
          identical protein binding
          hydroxyapatite binding
          SH3/SH2 adaptor activity
          GTPase activator activity
          SH3 domain binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-fkn7b:80/100.66.79.246:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline