Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGACTGTGGGTTGGGGAGATGGCA[A/G]GAAGGGGGCAAGGCCTTGTCCCAGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605893 MIM: 616667 | ||||||||||||||||||||
Literature Links: |
CDIPT PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CDIPT - CDP-diacylglycerol--inositol 3-phosphatidyltransferase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CDIPT-AS1 - CDIPT antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SEZ6L2 - seizure related 6 homolog like 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001114099.2 | 3224 | UTR 3 | NP_001107571.1 | |||
NM_001114100.2 | 3224 | UTR 3 | NP_001107572.1 | |||
NM_001243332.1 | 3224 | UTR 3 | NP_001230261.1 | |||
NM_001243333.1 | 3224 | UTR 3 | NP_001230262.1 | |||
NM_012410.3 | 3224 | UTR 3 | NP_036542.1 | |||
NM_201575.3 | 3224 | UTR 3 | NP_963869.2 | |||
XM_005255252.2 | 3224 | Intron | XP_005255309.1 | |||
XM_017023135.1 | 3224 | Intron | XP_016878624.1 |