Custom TaqMan™ SNP Genotyping Assay, non-human

We recommend using ~1-20 ng of good-quality gDNA per well. The gDNA should have an A260/A280 ratio of ~1.7-1.9. It is also important to try to add the same amount of gDNA to every well.

You can use our Custom Assay Design Tool (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-assays/snp-genotyping-taqman-assays/custom-snp-assays.html?ICID=ta-lm-custom%20taqman%20snp%20assay-Single%20Tube%20Custom%20TaqMan%C2%AE%20SNP%20Genotyping%20Assays) to submit your SNP sequence for an assay design. Alternatively, you can also use Primer Express Software to design an assay. The DNA sequence needs to have at least 30 bases on each side of the SNP site. The more sequence you provide, the greater chance you have of the tool creating a passing design. The ideal sequence length is ~ 200 bases on either side of the SNP site. For the best-performing assay, we recommend prescreening the sequence for other SNPs, repeats, and regions of low complexity. These variations should be masked prior to submitting the sequence. This will prevent the design tool from designing the primers or probe over those regions, which could reduce the efficiency of the assay if they were used. For more details on how to screen and mask the sequence, please follow the guidelines here (https://tools.thermofisher.com/content/sfs/manuals/cms_042307.pdf).

We recommend diluting the 40X and 80X TaqMan SNP Genotyping Assays to a 20X working stock with 1X TE buffer. The 1X TE buffer should be 10 mM Tris-HCl, 1 mM EDTA, pH 8.0, and be made using DNase-free, sterile-filtered water.

The context sequence indicates the nucleotide sequence surrounding the probe. The SNP is annotated in brackets as follows: [allele 1_VIC labeled/allele 2_FAM labeled]. As an example the context file may look like: CTCCTCTGACACTGTCGCTTCTCCA[T/C]GGCATTAGATTTTCAGTCCTGCTCA. Please note: 25 nucleotides on each side of the SNP site is included in the context sequence. In this example, the SNP [T/C] can be read as T = allele 1 and is VIC dye labeled, C = Allele 2 and is FAM dye labeled. The context sequence of the assay is always shown in the forward orientation, regardless of the strand on which the SNP is typically reported. It is important to compare the context sequence of the SNP assay to the SNP sequence in the NCBI’s dbSNP database to determine which dye is associated with the minor allele.

A detailed description that highlights all columns relevant to the DMEs can be found in the "Understanding Your Shipment Reference Guide" (https://assets.thermofisher.com/TFS-Assets/LSG/manuals/MAN0017153_UnderstandYourShipment_RG.pdf).