Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTGTGTGATATTCTTCCACCTTGG[A/G]TTCTCAGAAAACTTTGAACAGACTT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606382 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MAGI2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MAGI2 - membrane associated guanylate kinase, WW and PDZ domain containing 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001301128.1 | Intron | NP_001288057.1 | ||||
NM_012301.3 | Intron | NP_036433.2 | ||||
XM_011516718.1 | Intron | XP_011515020.1 | ||||
XM_011516719.2 | Intron | XP_011515021.1 | ||||
XM_011516720.2 | Intron | XP_011515022.1 | ||||
XM_011516726.2 | Intron | XP_011515028.1 | ||||
XM_011516728.1 | Intron | XP_011515030.1 | ||||
XM_017012840.1 | Intron | XP_016868329.1 | ||||
XM_017012841.1 | Intron | XP_016868330.1 | ||||
XM_017012842.1 | Intron | XP_016868331.1 | ||||
XM_017012843.1 | Intron | XP_016868332.1 | ||||
XM_017012844.1 | Intron | XP_016868333.1 | ||||
XM_017012845.1 | Intron | XP_016868334.1 | ||||
XM_017012846.1 | Intron | XP_016868335.1 | ||||
XM_017012847.1 | Intron | XP_016868336.1 | ||||
XM_017012848.1 | Intron | XP_016868337.1 | ||||
XM_017012849.1 | Intron | XP_016868338.1 | ||||
XM_017012850.1 | Intron | XP_016868339.1 | ||||
XM_017012851.1 | Intron | XP_016868340.1 | ||||
XM_017012852.1 | Intron | XP_016868341.1 |
RPL13AP17 - ribosomal protein L13a pseudogene 17 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |