Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACGCACTTTCAAGTTTGTCACTTAA[A/G]CAATATATTCCTCCCCAACCGCTCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603277 MIM: 164031 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CHD4 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CHD4 - chromodomain helicase DNA binding protein 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001273.3 | Intron | NP_001264.2 | ||||
NM_001297553.1 | Intron | NP_001284482.1 | ||||
XM_005253668.3 | Intron | XP_005253725.1 | ||||
XM_006718958.1 | Intron | XP_006719021.1 | ||||
XM_006718959.1 | Intron | XP_006719022.1 | ||||
XM_006718960.1 | Intron | XP_006719023.1 | ||||
XM_006718961.2 | Intron | XP_006719024.1 | ||||
XM_006718962.1 | Intron | XP_006719025.1 | ||||
XM_017018725.1 | Intron | XP_016874214.1 | ||||
XM_017018726.1 | Intron | XP_016874215.1 | ||||
XM_017018727.1 | Intron | XP_016874216.1 | ||||
XM_017018728.1 | Intron | XP_016874217.1 | ||||
XM_017018729.1 | Intron | XP_016874218.1 | ||||
XM_017018730.1 | Intron | XP_016874219.1 | ||||
XM_017018731.1 | Intron | XP_016874220.1 | ||||
XM_017018732.1 | Intron | XP_016874221.1 | ||||
XM_017018733.1 | Intron | XP_016874222.1 | ||||
XM_017018734.1 | Intron | XP_016874223.1 |
NOP2 - NOP2 nucleolar protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SCARNA11 - small Cajal body-specific RNA 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |