Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGCGCCTGGGCAGGTAGCACACAT[C/T]TGTCCAAGAACATGCAAAAGACACC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 607764 MIM: 611052 MIM: 601485 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
HSD3B7 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
HSD3B7 - hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001142777.1 | 3983 | Intron | NP_001136249.1 | |||
NM_001142778.1 | 3983 | Intron | NP_001136250.1 | |||
NM_025193.3 | 3983 | Intron | NP_079469.2 | |||
XM_005255601.3 | 3983 | Intron | XP_005255658.2 | |||
XM_011545960.2 | 3983 | Intron | XP_011544262.1 | |||
XM_011545961.1 | 3983 | Intron | XP_011544263.1 | |||
XM_011545962.2 | 3983 | Intron | XP_011544264.1 | |||
XM_017023732.1 | 3983 | Intron | XP_016879221.1 |
SETD1A - SET domain containing 1A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STX1B - syntaxin 1B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_052874.4 | 3983 | UTR 3 | NP_443106.1 | |||
XM_017022893.1 | 3983 | UTR 3 | XP_016878382.1 |