Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTTGCTGGCAGCTGCGGCGGCCCC[A/C]GAACCAGGCACCCCACACGATCGCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609828 MIM: 610481 MIM: 614715 | ||||||||||||||||||||
Literature Links: |
FSD1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FSD1 - fibronectin type III and SPRY domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SHD - Src homology 2 domain containing transforming protein D | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMIGD2 - transmembrane and immunoglobulin domain containing 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001169126.1 | 571 | Missense Mutation | NP_001162597.1 | |||
NM_001308232.1 | 571 | Missense Mutation | NP_001295161.1 | |||
NM_144615.2 | 571 | Missense Mutation | NP_653216.2 | |||
XM_017026284.1 | 571 | Missense Mutation | XP_016881773.1 |