Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGGCTGCGGCGGCGTTGGCCTCTC[G/A]CAGGGCGCCTGCCAGCTTGTTGTTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604800 | ||||||||||||||||||||
Literature Links: |
DDX49 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DDX49 - DEAD-box helicase 49 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HOMER3 - homer scaffolding protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001145721.1 | 709 | Silent Mutation | NP_001139193.1 | |||
NM_001145722.1 | 709 | Silent Mutation | NP_001139194.1 | |||
NM_001145724.1 | 709 | Silent Mutation | NP_001139196.1 | |||
NM_004838.3 | 709 | Silent Mutation | NP_004829.3 | |||
XM_006722943.1 | 709 | Nonsense Mutation | XP_006723006.1 | |||
XM_006722944.1 | 709 | Nonsense Mutation | XP_006723007.1 |
LOC102724360 - uncharacterized LOC102724360 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |