Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGATGATGATGTTGGGGTCATTTT[A/C]AAGCCGCTCATCCAGCTCATGGTAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607068 MIM: 607072 MIM: 605082 MIM: 607069 MIM: 607070 | ||||||||||||||||||||
Literature Links: |
CYB561D2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CYB561D2 - cytochrome b561 family member D2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NPRL2 - NPR2-like, GATOR1 complex subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006545.4 | 1511 | Nonsense Mutation | GAA,TAA | E,* 370 | NP_006536.3 | |
XM_005264808.4 | 1511 | Nonsense Mutation | GAA,TAA | E,* 250 | XP_005264865.1 | |
XM_011533288.2 | 1511 | Nonsense Mutation | GAA,TAA | E,* 367 | XP_011531590.1 | |
XM_017005555.1 | 1511 | Nonsense Mutation | GAA,TAA | E,* 250 | XP_016861044.1 | |
XM_017005556.1 | 1511 | Nonsense Mutation | GAA,TAA | E,* 250 | XP_016861045.1 |
RASSF1 - Ras association domain family member 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RASSF1-AS1 - RASSF1 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM115 - transmembrane protein 115 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZMYND10 - zinc finger MYND-type containing 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |