Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATTAATGTATAGATTCCAATGGAA[G/T]AAATCTGAAATACTCTACTGTAGAA
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 606025 | |||||||||||||||||||||||
Literature Links: |
ZBTB20 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
ZBTB20 - zinc finger and BTB domain containing 20 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001164342.2 | Intron | NP_001157814.1 | ||||
NM_001164343.2 | Intron | NP_001157815.1 | ||||
NM_001164344.2 | Intron | NP_001157816.1 | ||||
NM_001164345.2 | Intron | NP_001157817.1 | ||||
NM_001164346.2 | Intron | NP_001157818.1 | ||||
NM_001164347.2 | Intron | NP_001157819.1 | ||||
NM_015642.5 | Intron | NP_056457.3 |
ZBTB20-AS1 - ZBTB20 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |