Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCAGGGCAATGCTGCGTCTGCCTTA[A/G]TTGCAGAGGAGGAGGACGAAGGGTT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602243 MIM: 601189 MIM: 602644 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CD151 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CD151 - CD151 molecule (Raph blood group) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
POLR2L - RNA polymerase II subunit L | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TSPAN4 - tetraspanin 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001025234.1 | 94 | Intron | NP_001020405.1 | |||
NM_001025235.1 | 94 | Intron | NP_001020406.1 | |||
NM_001025236.1 | 94 | Intron | NP_001020407.1 | |||
NM_001025237.1 | 94 | Intron | NP_001020408.1 | |||
NM_001025238.1 | 94 | Intron | NP_001020409.1 | |||
NM_001025239.1 | 94 | Intron | NP_001020410.1 | |||
NM_003271.4 | 94 | Intron | NP_003262.1 | |||
XM_005253102.1 | 94 | Intron | XP_005253159.1 | |||
XM_005253104.1 | 94 | Intron | XP_005253161.1 | |||
XM_011520336.1 | 94 | Intron | XP_011518638.1 | |||
XM_011520337.2 | 94 | UTR 5 | XP_011518639.1 | |||
XM_011520338.1 | 94 | Intron | XP_011518640.1 | |||
XM_011520339.2 | 94 | UTR 5 | XP_011518641.1 | |||
XM_011520340.2 | 94 | Intron | XP_011518642.1 | |||
XM_011520341.2 | 94 | Intron | XP_011518643.1 |