Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTGGGCCCTGCTCTGCTGCAAAAG[A/G]CAAGTGGGGAAGCCCGCTCGCTGCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 131370 MIM: 176610 MIM: 610431 MIM: 610056 | ||||||||||||||||||||
Literature Links: |
ENO3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ENO3 - enolase 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001193503.1 | Intron | NP_001180432.1 | ||||
NM_001976.4 | Intron | NP_001967.3 | ||||
NM_053013.3 | Intron | NP_443739.3 | ||||
XM_005256521.2 | Intron | XP_005256578.1 | ||||
XM_011523729.1 | Intron | XP_011522031.1 | ||||
XM_017024346.1 | Intron | XP_016879835.1 |
PFN1 - profilin 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNF167 - ring finger protein 167 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPAG7 - sperm associated antigen 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |