Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCAGGAAGAAATCCACATGGGGCCT[A/C]TTATGTACAAAAAACCGGACAGGAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610684 MIM: 615019 MIM: 605125 MIM: 612910 | ||||||||||||||||||||
Literature Links: |
CTDNEP1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CTDNEP1 - CTD nuclear envelope phosphatase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001143775.1 | 777 | Intron | NP_001137247.1 | |||
NM_015343.4 | 777 | Silent Mutation | NP_056158.2 |
ELP5 - elongator acetyltransferase complex subunit 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GABARAP - GABA type A receptor-associated protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PHF23 - PHD finger protein 23 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |