Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATCTCAGGGTTAATCGGGTTCCCA[G/T]CACATCACATTCCCTGGGTAAAAGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 151523 MIM: 607972 MIM: 601729 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CD37 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CD37 - CD37 molecule | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC6A16 - solute carrier family 6 member 16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TEAD2 - TEA domain transcription factor 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256658.1 | Intron | NP_001243587.1 | ||||
NM_001256659.1 | Intron | NP_001243588.1 | ||||
NM_001256660.1 | Intron | NP_001243589.1 | ||||
NM_001256661.1 | Intron | NP_001243590.1 | ||||
NM_001256662.1 | Intron | NP_001243591.1 | ||||
NM_003598.1 | Intron | NP_003589.1 | ||||
XM_005259334.3 | Intron | XP_005259391.1 | ||||
XM_006723424.1 | Intron | XP_006723487.1 | ||||
XM_006723428.2 | Intron | XP_006723491.1 | ||||
XM_006723429.2 | Intron | XP_006723492.1 | ||||
XM_011527398.1 | Intron | XP_011525700.1 | ||||
XM_011527399.2 | Intron | XP_011525701.1 | ||||
XM_011527400.2 | Intron | XP_011525702.1 | ||||
XM_011527401.1 | Intron | XP_011525703.1 | ||||
XM_011527402.2 | Intron | XP_011525704.1 | ||||
XM_011527403.1 | Intron | XP_011525705.1 | ||||
XM_011527404.1 | Intron | XP_011525706.1 | ||||
XM_011527405.2 | Intron | XP_011525707.1 | ||||
XM_011527406.2 | Intron | XP_011525708.1 |