Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCAGGCAGGAGAGAATGTGACCTTG[C/T]CCTGCAGCTCCATCTATCCAGGGAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604955 MIM: 604946 | ||||||||||||||||||||
Literature Links: |
KIR2DS4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KIR2DS4 - killer cell immunoglobulin like receptor, two Ig domains and short cytoplasmic tail 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001281971.1 | 531 | Missense Mutation | CCC,TCC | P,S 148 | NP_001268900.1 | |
NM_001281972.1 | 531 | Missense Mutation | CCC,TCC | P,S 148 | NP_001268901.1 | |
NM_012314.5 | 531 | Missense Mutation | CCC,TCC | P,S 148 | NP_036446.3 |
KIR3DL1 - killer cell immunoglobulin like receptor, three Ig domains and long cytoplasmic tail 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |