Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAGACGGGCGGGTATGGGCCGCGC[C/G]GGCGCAGGCTCCCCCGGGCGCCGCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 138322 MIM: 180664 MIM: 615729 | ||||||||||||||||||||
Literature Links: |
GPX4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GPX4 - glutathione peroxidase 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001039847.2 | 97 | Intron | NP_001034936.1 | |||
NM_001039848.2 | 97 | Silent Mutation | GCC,GCG | A,A 4 | NP_001034937.1 | |
NM_002085.4 | 97 | Intron | NP_002076.2 |
POLR2E - RNA polymerase II subunit E | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SBNO2 - strawberry notch homolog 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |