Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCGAGGGCACCGCGGCCCCGCTTCA[C/G]ACGGTGACCTCGGTCTTGCTATTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612156 MIM: 600481 | ||||||||||||||||||||
Literature Links: |
MIR33A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR33A - microRNA 33a | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SHISA8 - shisa family member 8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001207020.1 | 1439 | Silent Mutation | GTC,GTG | V,V 397 | NP_001193949.1 | |
XM_006724254.3 | 1439 | Silent Mutation | GTC,GTG | V,V 492 | XP_006724317.1 | |
XM_006724255.2 | 1439 | Silent Mutation | GTC,GTG | V,V 456 | XP_006724318.1 | |
XM_006724256.3 | 1439 | Silent Mutation | GTC,GTG | V,V 452 | XP_006724319.1 |
SREBF2 - sterol regulatory element binding transcription factor 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |