Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGGTCCTAACCCGCTATCCCCTTG[C/G]AGCTCAACAACAACACAACGCAGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 107777 MIM: 600442 MIM: 601383 | ||||||||||||||||||||
Literature Links: |
AQP2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AQP2 - aquaporin 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
AQP5 - aquaporin 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001651.3 | Intron | NP_001642.1 | ||||
XM_005268838.2 | Intron | XP_005268895.1 |
AQP6 - aquaporin 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101927318 - uncharacterized LOC101927318 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |