Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAACCTGGAGTGGCACCTGGGGCT[C/T]GGAGAAGGAGAAAAGGTGAAGGAGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610215 MIM: 601873 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ARHGEF25 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ARHGEF25 - Rho guanine nucleotide exchange factor 25 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
B4GALNT1 - beta-1,4-N-acetyl-galactosaminyltransferase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001276468.1 | 1640 | Intron | NP_001263397.1 | |||
NM_001276469.1 | 1640 | Intron | NP_001263398.1 | |||
NM_001478.4 | 1640 | Intron | NP_001469.1 | |||
XM_005268773.4 | 1640 | UTR 3 | XP_005268830.1 | |||
XM_011538147.2 | 1640 | UTR 3 | XP_011536449.1 | |||
XM_011538148.2 | 1640 | UTR 3 | XP_011536450.1 | |||
XM_017019140.1 | 1640 | UTR 3 | XP_016874629.1 | |||
XM_017019141.1 | 1640 | UTR 3 | XP_016874630.1 | |||
XM_017019142.1 | 1640 | UTR 3 | XP_016874631.1 |
LOC101927583 - uncharacterized LOC101927583 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC26A10 - solute carrier family 26 member 10 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_133489.2 | 1640 | Silent Mutation | CTC,CTT | L,L 443 | NP_597996.2 |