Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTCCTTACCCTTGTCATTAGTGAT[A/G]GTAATCTTGTTCTCTTTTCCCGTAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600816 | ||||||||||||||||||||
Literature Links: |
HSPA8 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HSPA8 - heat shock protein family A (Hsp70) member 8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006597.5 | 1783 | Silent Mutation | NP_006588.1 | |||
NM_153201.3 | 1783 | Intron | NP_694881.1 | |||
XM_011542798.1 | 1783 | Intron | XP_011541100.1 |
SNORD14C - small nucleolar RNA, C/D box 14C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD14D - small nucleolar RNA, C/D box 14D | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD14E - small nucleolar RNA, C/D box 14E | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |