Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGATCGATGAGGTGGTGAGCCCAGA[A/G]CCCGAGCCCCTCAACACGTCTGACT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609374 MIM: 615738 | ||||||||||||||||||||
Literature Links: |
CDCA5 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CDCA5 - cell division cycle associated 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM262 - transmembrane protein 262 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
VPS51 - VPS51, GARP complex subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZFPL1 - zinc finger protein like 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006782.3 | 597 | Silent Mutation | GAA,GAG | E,E 144 | NP_006773.2 |