Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCAAGGACATCAAGAAGATCTTGGA[C/G]AGCGTGGGTATCGAGGCGGACGACG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 605247 MIM: 609059 MIM: 180530 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
PIDD1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
PIDD1 - p53-induced death domain protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_145886.3 | Intron | NP_665893.2 | ||||
NM_145887.3 | Intron | NP_665894.2 | ||||
XM_005253005.4 | Intron | XP_005253062.1 | ||||
XM_005253006.4 | Intron | XP_005253063.1 | ||||
XM_005253007.3 | Intron | XP_005253064.1 | ||||
XM_005253008.4 | Intron | XP_005253065.1 | ||||
XM_011520209.2 | Intron | XP_011518511.1 | ||||
XM_011520210.2 | Intron | XP_011518512.1 | ||||
XM_011520211.2 | Intron | XP_011518513.1 | ||||
XM_011520212.1 | Intron | XP_011518514.1 | ||||
XM_011520213.2 | Intron | XP_011518515.1 | ||||
XM_017017993.1 | Intron | XP_016873482.1 |
PNPLA2 - patatin like phospholipase domain containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPLP2 - ribosomal protein lateral stalk subunit P2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001004.3 | Intron | NP_000995.1 |
SNORA52 - small nucleolar RNA, H/ACA box 52 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |