Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAAGGCTGCAGCTCCCAGAGTCAGG[C/T]AGAGCTGGAGACGCTGCCGGGGGAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611288 MIM: 612565 MIM: 611484 | ||||||||||||||||||||
Literature Links: |
CNIH2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CNIH2 - cornichon family AMPA receptor auxiliary protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_182553.2 | 1059 | Intron | NP_872359.1 |
RAB1B - RAB1B, member RAS oncogene family | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM151A - transmembrane protein 151A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
YIF1A - Yip1 interacting factor homolog A, membrane trafficking protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001300861.1 | 1059 | Missense Mutation | TAC,TGC | Y,C 219 | NP_001287790.1 | |
NM_020470.2 | 1059 | Missense Mutation | TAC,TGC | Y,C 271 | NP_065203.2 | |
XM_005273720.3 | 1059 | Missense Mutation | ACC,GCC | T,A 301 | XP_005273777.1 | |
XM_017017139.1 | 1059 | Missense Mutation | ACC,GCC | T,A 313 | XP_016872628.1 | |
XM_017017140.1 | 1059 | Missense Mutation | TAC,TGC | Y,C 283 | XP_016872629.1 | |
XM_017017141.1 | 1059 | Intron | XP_016872630.1 |