Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAGAGGAAAATGGGTGCCACTTTC[C/T]AGTGGTTGAGCTAGTTCTGAAATGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602325 | ||||||||||||||||||||
Literature Links: |
EIF4G2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EIF4G2 - eukaryotic translation initiation factor 4 gamma 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001042559.2 | 2298 | Silent Mutation | CTA,CTG | L,L 627 | NP_001036024.3 | |
NM_001172705.1 | 2298 | Silent Mutation | CTA,CTG | L,L 665 | NP_001166176.1 | |
NM_001418.3 | 2298 | Silent Mutation | CTA,CTG | L,L 665 | NP_001409.3 |
LOC101928053 - uncharacterized LOC101928053 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD97 - small nucleolar RNA, C/D box 97 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |