Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCCATGTCTATCGTTATCACAGAG[G/T]CGAGTCGAAGCTGCACATGTGCTTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609191 MIM: 140750 | ||||||||||||||||||||
Literature Links: |
AKIP1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AKIP1 - A-kinase interacting protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001206646.1 | 388 | Missense Mutation | GGC,GTC | G,V 95 | NP_001193575.1 | |
NM_001206647.1 | 388 | Missense Mutation | GGC,GTC | G,V 122 | NP_001193576.1 | |
NM_001206648.1 | 388 | Missense Mutation | GGC,GTC | G,V 95 | NP_001193577.1 | |
NM_020642.3 | 388 | Missense Mutation | GGC,GTC | G,V 122 | NP_065693.2 | |
XM_017018011.1 | 388 | Missense Mutation | GGC,GTC | G,V 122 | XP_016873500.1 | |
XM_017018012.1 | 388 | Missense Mutation | GGC,GTC | G,V 95 | XP_016873501.1 |
C11orf16 - chromosome 11 open reading frame 16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ST5 - suppression of tumorigenicity 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |