Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTCCTAATGACTGCTCTTCTCGTAC[C/T]ACGTGCTTGCCTGGTGATGAGATCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 103950 MIM: 604874 | ||||||||||||||||||||
Literature Links: |
A2M PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
A2M - alpha-2-macroglobulin | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
A2M-AS1 - A2M antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KLRG1 - killer cell lectin like receptor G1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005810.3 | Intron | NP_005801.3 | ||||
XM_017018682.1 | Intron | XP_016874171.1 | ||||
XM_017018683.1 | Intron | XP_016874172.1 | ||||
XM_017018684.1 | Intron | XP_016874173.1 | ||||
XM_017018685.1 | Intron | XP_016874174.1 |
LINC00612 - long intergenic non-protein coding RNA 612 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |