Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAAATGGGAAAAATCAAATGGTGAT[G/T]GCATTTTTTCATCCATACTGCAATG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613666 MIM: 606882 MIM: 608969 | ||||||||||||||||||||
Literature Links: |
ALG11 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ALG11 - ALG11, alpha-1,2-mannosyltransferase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001004127.2 | 227 | Missense Mutation | ATG,ATT | M,I 65 | NP_001004127.2 |
ATP7B - ATPase copper transporting beta | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UTP14C - UTP14, small subunit processome component homolog C (S. cerevisiae) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |