Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCTAAAACTAAGCCCTCTCCCCAG[C/T]CTGATGCCCAGCCTTTCTGCTGCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610051 MIM: 603171 MIM: 610711 | ||||||||||||||||||||
Literature Links: |
CHMP4A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CHMP4A - charged multivesicular body protein 4A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MDP1 - magnesium dependent phosphatase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NEDD8 - neural precursor cell expressed, developmentally down-regulated 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NEDD8-MDP1 - NEDD8-MDP1 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TSSK4 - testis specific serine kinase 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001184739.1 | 645 | Silent Mutation | CGC,CGT | R,R 147 | NP_001171668.1 | |
NM_001308067.1 | 645 | Intron | NP_001294996.1 | |||
NM_174944.3 | 645 | Intron | NP_777604.2 | |||
XM_011536663.2 | 645 | Silent Mutation | CGC,CGT | R,R 71 | XP_011534965.1 | |
XM_017021226.1 | 645 | Intron | XP_016876715.1 |