Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGAACAAGTCCATGCTGCCATCAAG[A/G]CATTTATTGCAGTGTACTATTTGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607089 MIM: 177070 | ||||||||||||||||||||
Literature Links: |
CCNDBP1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CCNDBP1 - cyclin D1 binding protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_012142.4 | 523 | Missense Mutation | ACA,GCA | T,A 98 | NP_036274.3 | |
XM_006720448.1 | 523 | Missense Mutation | ACA,GCA | T,A 142 | XP_006720511.1 |
EPB42 - erythrocyte membrane protein band 4.2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM62 - transmembrane protein 62 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |