Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGCTGCATCAACGTGTGTGGACTG[C/T]ACAGCTGCGTGGCAGCACGCTTCCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608021 | ||||||||||||||||||||
Literature Links: |
LOC100287175 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC100287175 - uncharacterized LOC100287175 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MCRIP2 - MAPK regulated corepressor interacting protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
METTL26 - methyltransferase like 26 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RAB40C - RAB40C, member RAS oncogene family | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WFIKKN1 - WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_053284.2 | 459 | Missense Mutation | CAC,TAC | H,Y 73 | NP_444514.1 |