Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAAGGTGCCCACCCACATCGTGGA[C/T]TACTCAGGTAGCGGCCGTAGCCTCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603264 MIM: 613889 | ||||||||||||||||||||
Literature Links: |
LOC105371184 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC105371184 - uncharacterized LOC105371184 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RHBDL1 - rhomboid like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WDR90 - WD repeat domain 90 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_145294.4 | 288 | Intron | NP_660337.3 | |||
XM_017023023.1 | 288 | Intron | XP_016878512.1 | |||
XM_017023024.1 | 288 | Intron | XP_016878513.1 |