Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCCAGGTCCTCCAAGACCACCAGC[C/T]GGGGCCACCCAGGATGAGGAGCTAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609526 MIM: 600477 | ||||||||||||||||||||
Literature Links: |
KCTD19 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KCTD19 - potassium channel tetramerization domain containing 19 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PLEKHG4 - pleckstrin homology and RhoGEF domain containing G4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001129727.2 | 504 | Silent Mutation | GCC,GCT | A,A 53 | NP_001123199.1 | |
NM_001129728.1 | 504 | Silent Mutation | GCC,GCT | A,A 53 | NP_001123200.1 | |
NM_001129729.2 | 504 | Silent Mutation | GCC,GCT | A,A 53 | NP_001123201.1 | |
NM_001129731.2 | 504 | Silent Mutation | GCC,GCT | A,A 53 | NP_001123203.1 | |
XM_011522985.2 | 504 | Silent Mutation | GCC,GCT | A,A 53 | XP_011521287.1 | |
XM_011522986.2 | 504 | Silent Mutation | GCC,GCT | A,A 53 | XP_011521288.1 | |
XM_011522987.2 | 504 | Silent Mutation | GCC,GCT | A,A 53 | XP_011521289.1 | |
XM_011522988.2 | 504 | Silent Mutation | GCC,GCT | A,A 53 | XP_011521290.1 |
SLC9A5 - solute carrier family 9 member A5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |