Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAAGGACAGTAGAGGGCGGAAGCTC[C/T]AGCGTCTTCTCCATGTTCGACCAGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612897 MIM: 613620 | ||||||||||||||||||||
Literature Links: |
LOC107983970 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC107983970 - uncharacterized LOC107983970 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MYLPF - myosin light chain, phosphorylatable, fast skeletal muscle | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001324458.1 | 294 | Silent Mutation | TCC,TCT | S,S 16 | NP_001311387.1 | |
NM_001324459.1 | 294 | Silent Mutation | TCC,TCT | S,S 16 | NP_001311388.1 | |
NM_013292.4 | 294 | Silent Mutation | TCC,TCT | S,S 16 | NP_037424.2 |
SEPT1 - septin 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TBC1D10B - TBC1 domain family member 10B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF48 - zinc finger protein 48 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |