Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATCGGCATTTCTGTGGATCCGAGGA[A/G]GCGGAACAAGTCCACGGAGTCCCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 113703 MIM: 602783 | ||||||||||||||||||||
Literature Links: |
RPL13 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
RPL13 - ribosomal protein L13 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000977.3 | 381 | Missense Mutation | AAG,AGG | K,R 102 | NP_000968.2 | |
NM_001243130.1 | 381 | Missense Mutation | AAG,AGG | K,R 83 | NP_001230059.1 | |
NM_001243131.1 | 381 | Intron | NP_001230060.1 | |||
NM_033251.2 | 381 | Missense Mutation | AAG,AGG | K,R 102 | NP_150254.1 |
SNORD68 - small nucleolar RNA, C/D box 68 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPG7 - SPG7, paraplegin matrix AAA peptidase subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |