Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTCCTCTGTGAAGTGCTCATCTGG[G/T]TAGGTGCCCAGGGGCCTCTGGGAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603741 MIM: 607206 | ||||||||||||||||||||
Literature Links: |
ALOX12B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ALOX12B - arachidonate 12-lipoxygenase, 12R type | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ALOXE3 - arachidonate lipoxygenase 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001165960.1 | 2344 | Nonsense Mutation | TAA,TAC | *,Y 790 | NP_001159432.1 | |
NM_021628.2 | 2344 | Nonsense Mutation | TAA,TAC | *,Y 658 | NP_067641.2 | |
XM_017024921.1 | 2344 | Intron | XP_016880410.1 | |||
XM_017024922.1 | 2344 | Intron | XP_016880411.1 | |||
XM_017024923.1 | 2344 | Intron | XP_016880412.1 | |||
XM_017024924.1 | 2344 | Intron | XP_016880413.1 | |||
XM_017024925.1 | 2344 | Intron | XP_016880414.1 |
MIR4314 - microRNA 4314 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |