Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAAGCTGGGGGACAGGCCCTTGAAG[A/C]AGCCCAGGGCGCCTTCCTTTTGCAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612072 MIM: 611974 MIM: 606521 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LOC100287042 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LOC100287042 - uncharacterized LOC100287042 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIF4GD - MIF4G domain containing | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MRPS7 - mitochondrial ribosomal protein S7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC25A19 - solute carrier family 25 member 19 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001126121.1 | 1259 | Missense Mutation | TGC,TTC | C,F 281 | NP_001119593.1 | |
NM_001126122.1 | 1259 | Missense Mutation | TGC,TTC | C,F 281 | NP_001119594.1 | |
NM_021734.4 | 1259 | Missense Mutation | TGC,TTC | C,F 281 | NP_068380.3 | |
XM_005257559.3 | 1259 | Missense Mutation | TGC,TTC | C,F 281 | XP_005257616.1 | |
XM_005257560.2 | 1259 | Missense Mutation | TGC,TTC | C,F 281 | XP_005257617.1 | |
XM_005257561.3 | 1259 | Missense Mutation | TGC,TTC | C,F 281 | XP_005257618.1 | |
XM_005257562.2 | 1259 | Missense Mutation | TGC,TTC | C,F 281 | XP_005257619.1 | |
XM_006722007.2 | 1259 | Missense Mutation | TGC,TTC | C,F 281 | XP_006722070.1 | |
XM_011525098.1 | 1259 | Missense Mutation | TGC,TTC | C,F 176 | XP_011523400.1 | |
XM_017024926.1 | 1259 | Missense Mutation | TGC,TTC | C,F 281 | XP_016880415.1 | |
XM_017024927.1 | 1259 | Missense Mutation | TGC,TTC | C,F 180 | XP_016880416.1 | |
XM_017024928.1 | 1259 | Missense Mutation | TGC,TTC | C,F 176 | XP_016880417.1 |