Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGAGCAGCTACTTGCCGTGGTGTTC[A/G]AAAGGAATGCTATTCTGAGGTGGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600864 MIM: 603877 | ||||||||||||||||||||
Literature Links: |
CSNK1D PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CSNK1D - casein kinase 1 delta | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001893.4 | 1549 | Intron | NP_001884.2 | |||
NM_139062.2 | 1549 | Silent Mutation | NP_620693.1 | |||
XM_005256336.3 | 1549 | Intron | XP_005256393.1 | |||
XM_005256337.4 | 1549 | Intron | XP_005256394.1 | |||
XM_017024199.1 | 1549 | Intron | XP_016879688.1 |
MIR6787 - microRNA 6787 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC16A3 - solute carrier family 16 member 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |