Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTTCCTAGGCATTTGAGGAGACTC[A/C]TCTGACCTCCCTTGACCCAGTGAAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603287 | ||||||||||||||||||||
Literature Links: |
PNPO PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PNPO - pyridoxamine 5'-phosphate oxidase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_018129.3 | 498 | Missense Mutation | CAT,CCT | H,P 52 | NP_060599.1 | |
XM_005257500.3 | 498 | UTR 5 | XP_005257557.1 | |||
XM_011524968.2 | 498 | Intron | XP_011523270.1 | |||
XM_017024813.1 | 498 | UTR 5 | XP_016880302.1 |
PRR15L - proline rich 15 like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SP2-AS1 - SP2 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |