Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCCCATCAACACAGCTTCCCCAAC[A/G]CCTGGGCAGCACACCGGATCCCTGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604171 MIM: 614534 MIM: 607996 MIM: 602679 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ALYREF PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ALYREF - Aly/REF export factor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ANAPC11 - anaphase promoting complex subunit 11 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001002244.2 | 384 | Silent Mutation | ACA,ACG | T,T 74 | NP_001002244.1 | |
NM_001002245.2 | 384 | Intron | NP_001002245.1 | |||
NM_001002246.2 | 384 | Intron | NP_001002246.1 | |||
NM_001002247.2 | 384 | Intron | NP_001002247.1 | |||
NM_001002248.2 | 384 | Intron | NP_001002248.1 | |||
NM_001002249.2 | 384 | Intron | NP_001002249.1 | |||
NM_001289414.1 | 384 | Intron | NP_001276343.1 | |||
NM_001289415.1 | 384 | Intron | NP_001276344.1 | |||
NM_001289416.1 | 384 | Intron | NP_001276345.1 | |||
NM_001289417.1 | 384 | Intron | NP_001276346.1 | |||
NM_001289418.1 | 384 | Intron | NP_001276347.1 | |||
NM_001289419.1 | 384 | Intron | NP_001276348.1 | |||
NM_001289420.1 | 384 | Intron | NP_001276349.1 | |||
NM_016476.11 | 384 | Intron | NP_057560.8 |
NPB - neuropeptide B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCYT2 - phosphate cytidylyltransferase 2, ethanolamine | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |