Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTTGCTGCCCCTCCGGGCCATTGAG[C/T]GCATAGGCTACAAGGTGACATTGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608163 MIM: 603691 MIM: 604858 MIM: 610935 | ||||||||||||||||||||
Literature Links: |
EXOC7 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EXOC7 - exocyst complex component 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001013839.3 | 864 | UTR 3 | NP_001013861.1 | |||
NM_001145297.3 | 864 | UTR 3 | NP_001138769.1 | |||
NM_001145298.3 | 864 | UTR 3 | NP_001138770.1 | |||
NM_001145299.3 | 864 | UTR 3 | NP_001138771.1 | |||
NM_001282313.1 | 864 | UTR 3 | NP_001269242.1 | |||
NM_001282314.1 | 864 | Intron | NP_001269243.1 | |||
NM_015219.4 | 864 | UTR 3 | NP_056034.2 | |||
XM_006721786.3 | 864 | UTR 3 | XP_006721849.1 | |||
XM_006721787.3 | 864 | UTR 3 | XP_006721850.1 | |||
XM_006721788.3 | 864 | UTR 3 | XP_006721851.1 | |||
XM_006721789.3 | 864 | UTR 3 | XP_006721852.1 | |||
XM_011524571.2 | 864 | UTR 3 | XP_011522873.1 | |||
XM_011524572.2 | 864 | Intron | XP_011522874.1 | |||
XM_017024397.1 | 864 | UTR 3 | XP_016879886.1 |
GALR2 - galanin receptor 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SRP68 - signal recognition particle 68 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZACN - zinc activated ion channel | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_180990.3 | 864 | Missense Mutation | CGC,TGC | R,C 261 | NP_851321.2 |