Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTAGGGACCATCTTGCTACCCGCT[A/G]TCACCATGCTGGGCTTCGGCTTCCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611577 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CYB5D1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CYB5D1 - cytochrome b5 domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KDM6B - lysine demethylase 6B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001080424.1 | 181 | Intron | NP_001073893.1 | |||
XM_005256549.3 | 181 | Intron | XP_005256606.1 | |||
XM_005256550.4 | 181 | Intron | XP_005256607.1 | |||
XM_005256551.3 | 181 | Intron | XP_005256608.1 | |||
XM_005256552.4 | 181 | Intron | XP_005256609.1 | |||
XM_006721483.3 | 181 | Intron | XP_006721546.1 | |||
XM_011523750.2 | 181 | Intron | XP_011522052.1 | |||
XM_011523752.2 | 181 | Intron | XP_011522054.1 | |||
XM_017024381.1 | 181 | Intron | XP_016879870.1 |
NAA38 - N(alpha)-acetyltransferase 38, NatC auxiliary subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM88 - transmembrane protein 88 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001319941.1 | 181 | Missense Mutation | ATC,GTC | I,V 58 | NP_001306870.1 | |
NM_203411.1 | 181 | Missense Mutation | ATC,GTC | I,V 58 | NP_981956.1 | |
XM_005256856.3 | 181 | Missense Mutation | ATC,GTC | I,V 58 | XP_005256913.1 |