Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCTGGCGTTGGGCGTGCGGCGGGC[C/T]GTCTTGCAGCTTCCAGGGTGAGAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606006 MIM: 612072 MIM: 611974 | ||||||||||||||||||||
Literature Links: |
GGA3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GGA3 - golgi associated, gamma adaptin ear containing, ARF binding protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001172703.2 | 299 | Intron | NP_001166174.1 | |||
NM_001172704.2 | 299 | Intron | NP_001166175.1 | |||
NM_001291641.1 | 299 | Intron | NP_001278570.1 | |||
NM_001291642.1 | 299 | Intron | NP_001278571.1 | |||
NM_014001.4 | 299 | Intron | NP_054720.1 | |||
NM_138619.3 | 299 | Intron | NP_619525.1 | |||
XM_011524563.2 | 299 | Intron | XP_011522865.1 | |||
XM_017024385.1 | 299 | Intron | XP_016879874.1 | |||
XM_017024386.1 | 299 | Intron | XP_016879875.1 | |||
XM_017024387.1 | 299 | Intron | XP_016879876.1 | |||
XM_017024388.1 | 299 | Intron | XP_016879877.1 | |||
XM_017024389.1 | 299 | Intron | XP_016879878.1 | |||
XM_017024390.1 | 299 | Intron | XP_016879879.1 | |||
XM_017024391.1 | 299 | Intron | XP_016879880.1 | |||
XM_017024392.1 | 299 | Intron | XP_016879881.1 |
LOC100287042 - uncharacterized LOC100287042 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIF4GD - MIF4G domain containing | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MRPS7 - mitochondrial ribosomal protein S7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015971.3 | 299 | Silent Mutation | GCC,GCT | A,A 22 | NP_057055.2 |