Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCATGAAATTTATTGGCAATGAAGC[C/T]GCATGTATACCAGGCTCCCCTAGTC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602346 MIM: 601674 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CNTNAP1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CNTNAP1 - contactin associated protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003632.2 | 4370 | Intron | NP_003623.1 | |||
XM_005257748.4 | 4370 | Intron | XP_005257805.1 | |||
XM_017025238.1 | 4370 | Intron | XP_016880727.1 |
EZH1 - enhancer of zeste 1 polycomb repressive complex 2 subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001321079.1 | 4370 | UTR 3 | NP_001308008.1 | |||
NM_001321081.1 | 4370 | UTR 3 | NP_001308010.1 | |||
NM_001321082.1 | 4370 | UTR 3 | NP_001308011.1 | |||
NM_001991.4 | 4370 | UTR 3 | NP_001982.2 | |||
XM_005257145.2 | 4370 | UTR 3 | XP_005257202.1 | |||
XM_011524517.2 | 4370 | UTR 3 | XP_011522819.1 | |||
XM_017024350.1 | 4370 | UTR 3 | XP_016879839.1 | |||
XM_017024351.1 | 4370 | UTR 3 | XP_016879840.1 | |||
XM_017024352.1 | 4370 | UTR 3 | XP_016879841.1 |
MIR6780A - microRNA 6780a | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |